Stem-loop sequence ssc-mir-424

AccessionMI0013135 (change log)
DescriptionSus scrofa miR-424 stem-loop
Gene family MIPF0000164; mir-322
Literature search

9 open access papers mention ssc-mir-424
(86 sentences)

Stem-loop
   uc       a  c      aa            agg   uu 
5'   cgagggg ug agcagc  uucauguuuuga   gcu  a
     ||||||| || ||||||  ||||||||||||   |||   
3'   gcucccc au ucgucg  gagugcaaaacu   ugg  a
   -c       c  a      cg            ---   ua 
Get sequence
Deep sequencing
3967 reads, 447 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-424-5p

Accession MIMAT0013920
Previous IDsssc-miR-424
Sequence

13 - 

cagcagcaauucauguuuugaa

 - 34

Get sequence
Deep sequencing3861 reads, 15 experiments
Evidence experimental; Illumina [1,3], cloned [2]

Mature sequence ssc-miR-424-3p

Accession MIMAT0013921
Previous IDsssc-miR-424*
Sequence

50 - 

caaaacgugaggcgcugcuau

 - 70

Get sequence
Deep sequencing105 reads, 14 experiments
Evidence experimental; Illumina [1,3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).