Stem-loop sequence ssc-mir-335

AccessionMI0013165 (change log)
DescriptionSus scrofa miR-335 stem-loop
Gene family MIPF0000196; mir-335
Literature search

6 open access papers mention ssc-mir-335
(10 sentences)

Stem-loop
   cuuu    c        a         c        u  gu 
5'     uggg ggggguca gagcaauaa gaaaaaug uu  c
       |||| |||||||| ||||||||| |||||||| ||   
3'     acuc ccuccagu cucguuauu cuuuuugc aa  a
   ----    u        c         a        c  au 
Get sequence
Deep sequencing
4152 reads, 653 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 19338000-19338079 [-]
sense
ENSSSCT00000018024 ; MEST-201; intron 2
Database links

Mature sequence ssc-miR-335

Accession MIMAT0013955
Sequence

15 - 

ucaagagcaauaacgaaaaaug

 - 36

Get sequence
Deep sequencing3950 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).