Stem-loop sequence ssc-mir-129a

AccessionMI0013169 (change log)
Previous IDsssc-mir-129
DescriptionSus scrofa miR-129a stem-loop
Gene family MIPF0000073; mir-129
Literature search

5 open access papers mention ssc-mir-129a
(8 sentences)

Stem-loop
   cuu       -       c   cu      ---     acau 
5'    cgugaau cuuuuug ggu  gggcuu   gcugu    a
      ||||||| ||||||| |||  ||||||   |||||     
3'    gcgcuua gaaaaac cca  cccgaa   cgaua    a
   --g       c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 20324630-20324709 [-]
sense
ENSSSCT00000020716 ; ssc-mir-129a.1-201; exon 1
Database links

Mature sequence ssc-miR-129a-5p

Accession MIMAT0032108
Sequence

11 - 

cuuuuugcggucugggcuugc

 - 31

Get sequence
Deep sequencing67 reads, 11 experiments
Evidence experimental; Illumina [3]

Mature sequence ssc-miR-129a-3p

Accession MIMAT0013959
Previous IDsssc-miR-129a
Sequence

53 - 

aagcccuuaccccaaaaagcau

 - 74

Get sequence
Deep sequencing65 reads, 12 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).