Stem-loop sequence sbi-MIR162

AccessionMI0013252 (change log)
DescriptionSorghum bicolor miR162 stem-loop
Gene family MIPF0000169; MIR162_2
Stem-loop
   --  gc    u            uc     u  c    ---  u   ccagaa    ug    uuc 
5'   gg  gcag gguuuaucgauc  uuccu gc uugu   gc agu      guag  gugg   a
     ||  |||| ||||||||||||  ||||| || ||||   || |||      ||||  ||||   a
3'   cc  cguc ccaaauagcuag  aaggg cg aaca   cg uca      cguc  uauu   g
   ga  ua    u            cu     -  c    aaa  u   --auaa    gu    ugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 55732922-55733048 [+]
intergenic
Database links

Mature sequence sbi-miR162

Accession MIMAT0014041
Sequence

107 - 

ucgauaaaccucugcauccag

 - 127

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).