Stem-loop sequence sbi-MIR398

AccessionMI0013257 (change log)
DescriptionSorghum bicolor miR398 stem-loop
Gene family MIPF0000871; MIR398_2
Literature search

2 open access papers mention sbi-MIR398
(5 sentences)

Stem-loop
   --       ga             g a ug  -    g  ---auu    --    g 
5'   gggggcg  cugggaacacaug g a  ag agau ag      gcuc  gguc u
     |||||||  ||||||||||||| | |  || |||| ||      ||||  |||| g
3'   cccccgc  gacucuuguguac u u  uc ucua uu      cggg  ccgg c
   cg       ug             g a gu  g    g  gaugcu    uc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 15132480-15132588 [-]
intergenic
Database links

Mature sequence sbi-miR398

Accession MIMAT0014046
Sequence

88 - 

uguguucucaggucgcccccg

 - 108

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).