Stem-loop sequence sbi-MIR399k

AccessionMI0013258 (change log)
DescriptionSorghum bicolor miR399k stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399k
(5 sentences)

Stem-loop
   --a      cc    a        -  c acc 
5'    gggcaa  cucc uuggcagg ug g   u
      ||||||  |||| |||||||| || |    
3'    cccguu  gggg aaccgucc au c   a
   cgg      ua    a        c  c cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 9790202-9790264 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399k
sbi-MIR399jchr4: 9784852-9784944 [-]
sbi-MIR399kchr4: 9790202-9790264 [+]
Database links

Mature sequence sbi-miR399k

Accession MIMAT0014047
Sequence

42 - 

ugccaaaggggauuugcccgg

 - 62

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).