Stem-loop sequence sbi-MIR528

AccessionMI0013259 (change log)
DescriptionSorghum bicolor miR528 stem-loop
Gene family MIPF0000868; MIR528
Literature search

5 open access papers mention sbi-MIR528
(24 sentences)

Stem-loop
   --           u   g     ---  -      -----     u 
5'   uggaaggggca gca aggag   ca cgaggc     uuggc g
     ||||||||||| ||| |||||   || ||||||     ||||| g
3'   accuucuccgu cgu uccuc   gu gcuccg     agccg a
   uu           c   g     ucg  c      caucc     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 78558547-78558630 [-]
intergenic
Database links

Mature sequence sbi-miR528

Accession MIMAT0014048
Sequence

1 - 

uggaaggggcaugcagaggag

 - 21

Get sequence
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).