Stem-loop sequence ctr-MIR166

AccessionMI0013297 (change log)
DescriptionCitrus trifoliata miR166 stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention ctr-MIR166
(3 sentences)

Stem-loop
   -----------------------------------------------------------------------------------------------------------------------------------------------------------------gguuugucugaaggaucuag   uaauug      uu  ucuu   a        uu      cu   g c        -----------     uu    -uua        -    ca  u    guuucauu 
5'                                                                                                                                                                                      ggu      ggaagc  uu    uug ggggaaug  gucugg  cga g cacuaacu           agauc  ugau    aucucagu ugau  ua auuu        u
                                                                                                                                                                                        |||      ||||||  ||    ||| ||||||||  ||||||  ||| | ||||||||           |||||  ||||    |||||||| ||||  || ||||        u
3'                                                                                                                                                                                      ucg      ucuucg  aa    aac ccccuuac  cggacc  gcu c gugauuga           ucuag  acua    uagaguua auua  au uaaa        u
   gucaguuuuagaaaguaguaaugugguuagacgaguaccgguuacugguucuagagaggcaacugguauguuuauauguguuguguucuaguuauuuaauuuguuuuucuuuuuaacacuuuuuuaguugauuucaaacucuugacuagugucguggagguucuuuacuucuacuauagua   --ucua      uu  ---u   c        uu      ag   g a        auuaauagaau     uu    ccca        u    --  u    auaccuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR166

Accession MIMAT0014071
Sequence

191 - 

ucggaccaggcuucauuccccc

 - 212

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).