Stem-loop sequence ctr-MIR319

AccessionMI0013303 (change log)
DescriptionCitrus trifoliata miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention ctr-MIR319
(3 sentences)

Stem-loop
   -uua   --        uu          cu      u   aa            a -  g   ac       uc  aa    uaguaaa    cgaa 
5'     agc  ugggagcu  cuucggucca  uauggg ggc  uaggauuuaauu g cu cug  ucauuca  ca  uacu       gggu    a
       |||  ||||||||  ||||||||||  |||||| |||  |||||||||||| | || |||  |||||||  ||  ||||       ||||     
3'     ucg  acccucga  gaagucaggu  gugucc ucg  auucuaaguuaa c ga ggc  aguaagu  gu  auga       ccca    u
   ucgc   uu        gg          uc      u   -a            a a  g   gu       ga  aa    -------    uagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR319

Accession MIMAT0014077
Sequence

157 - 

uuggacugaagggagcuccc

 - 176

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).