Stem-loop sequence ctr-MIR164

AccessionMI0013306 (change log)
DescriptionCitrus trifoliata miR164 stem-loop
Gene family MIPF0000045; MIR164
Literature search

2 open access papers mention ctr-MIR164
(3 sentences)

Stem-loop
   ---------------------------------------------------------------------------------------gaagguguguguagag  a     a    c          cauuac         cgcacauacau   c     aaaauuaauuaauccacacauuuugaaga 
5'                                                                                                        ca gaugg gaag agggcacgug      uaacucaac           cua uaaca                             a
                                                                                                          || ||||| |||| ||||||||||      |||||||||           ||| |||||                             a
3'                                                                                                        gu cuacc cuuc ucccguguac      auugaguug           gau auugu                             c
   aaaccauccgaaaucuaaccguguacuuaaaacgauucuucuuuaagucuagaacucgacuagggacuacuaugugugugugugugcguguuccacggcgcca  a     c    u          uucuuu         aguacugacuc   -     ugucuuucucggaggacgaagaacuaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR164

Accession MIMAT0014080
Sequence

22 - 

uggagaagcagggcacgugca

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).