Stem-loop sequence ctr-MIR167

AccessionMI0013307 (change log)
DescriptionCitrus trifoliata miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention ctr-MIR167
(4 sentences)

Stem-loop
   cauau      -    g      u            c        aa        -  ccu 
5'      ucgugc acua uaguag ugaagcugccag augaucug  cuuuccuu ga   c
        |||||| |||| |||||| |||||||||||| ||||||||  |||||||| ||    
3'      gguacg uggu guuauc acuuugacgguc uacuagac  gaaaggga cu   c
   agacc      a    a      c            -        cg        u  cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR167

Accession MIMAT0014081
Sequence

24 - 

ugaagcugccagcaugaucuga

 - 45

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).