Stem-loop sequence ctr-MIR171

AccessionMI0013308 (change log)
DescriptionCitrus trifoliata miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention ctr-MIR171
(4 sentences)

Stem-loop
   -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------aucgacgguugaa                   aaucauca             c      uu   g          augg 
5'                                                                                                                                                                                                                                 ggggagaguuguaaaauga        agguauuggcgcg cucaau  aaa acgugguuaa    g
                                                                                                                                                                                                                                   |||||||||||||||||||        ||||||||||||| ||||||  ||| ||||||||||     
3'                                                                                                                                                                                                                                 ccucucucaauguuuuauu        ucuauaacugcgc gaguua  uuu uguaccgauu    c
   caacaaggacggccggaccucacucacuuacaaacucccuuuuauguucaaaagugaaguaauuguaguuuuacucugggguguacgggguuugcccagaauuuugaacggcaauacaaaggacgaaguuauuauaacuacuucuaaugaagauggcggaaacagacaaagacuuaggaguauacauagcuccucgucgacguauggcuuccgcuccuauaucu                   --aauucc             c      cu   a          agua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ctr-miR171

Accession MIMAT0014082
Sequence

104 - 

uugagccgcgucaauaucucc

 - 124

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).