Stem-loop sequence crt-MIR166a

Accession

MI0013310

Description

Citrus reticulata miR166a stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

uucccuucagaaucaaauucauuguuugauuuuuuuu      ---uua               uu      cu     g    c     ---uuu  a       uc   cuuucuuucu 
                                     gagagg      ugguugaugggaaug  guuugg  cgagg ucau uaggu      ca aauuuuc  gga          u
                                     ||||||      |||||||||||||||  ||||||  ||||| |||| |||||      || |||||||  |||           
                                     cucucu      gccaacugcccuuac  cggacc  gcucu agug auccg      gu uuaaaag  ccu          g
-----------------------------------uu      uuggca               uu      ag     -    u     uuuauu  a       ga   uuuuauuuuc 

Mature sequence crt-miR166a

• Accession: MIMAT0014084
• Sequence: 161 - ucggaccaggcuucauucccgu - 182
• Evidence: not experimental

References

1. PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).