Stem-loop sequence bma-let-7

AccessionMI0013319 (change log)
DescriptionBrugia malayi let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention bma-let-7
(28 sentences)

Stem-loop
   augcuaac   ccu  a      -     u  au   g          u      ---a   -gu    
5'         gac   ga ugauag cuugc cg  gag uaguagguug auaguu    uga   ugu 
           |||   || |||||| ||||| ||  ||| |||||||||| ||||||    |||   || a
3'         cug   cu acuauc gggcg gc  uuc aucguccgac ugucaa    gcu   acc 
   -----ccc   --c  -      u     u  cg   g          c      agag   aau    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold247: 47896-48019 [-]
intergenic
Clustered miRNAs
< 10kb from bma-let-7
bma-mir-100bBmal_v3_scaffold247: 48104-48194 [-]
bma-let-7Bmal_v3_scaffold247: 47896-48019 [-]
Database links

Mature sequence bma-let-7

Accession MIMAT0014094
Sequence

33 - 

ugagguaguagguuguauaguu

 - 54

Get sequence
Evidence experimental; Northern [1], Illumina [2]

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).