Stem-loop sequence aae-mir-306

AccessionMI0013446 (change log)
DescriptionAedes aegypti miR-306 stem-loop
Literature search

4 open access papers mention aae-mir-306
(20 sentences)

Stem-loop
   ca       uuu   c    c          -  a       augugcauuucucaagcaaucucg 
5'   uucgcaa   cac gguu agguacugag ug cucucag                        u
     |||||||   ||| |||| |||||||||| || |||||||                         
3'   aagcguu   gug ccga ucuauggcuc ac gagaguc                        c
   aa       ---   a    a          c  -       ccaaaaaguuggaguccaggacuc 
Get sequence
Deep sequencing
2250 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.785: 213059-213187 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-306
aae-mir-306supercont1.785: 213059-213187 [+]
aae-mir-79supercont1.785: 213262-213357 [+]
aae-mir-9bsupercont1.785: 213570-213661 [+]
Database links

Mature sequence aae-miR-306-5p

Accession MIMAT0014229
Previous IDsaae-miR-306
Sequence

20 - 

ucagguacugagugacucucag

 - 41

Get sequence
Deep sequencing2209 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-306-3p

Accession MIMAT0014230
Previous IDsaae-miR-306*
Sequence

94 - 

gagagcaccucgguaucuaagc

 - 115

Get sequence
Deep sequencing41 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).