Stem-loop sequence aae-mir-306

Accession

MI0013446 (change log)

Description

Aedes aegypti miR-306 stem-loop

Literature search

4 open access papers mention aae-mir-306
(20 sentences)

Stem-loop

   ca       uuu   c    c          -  a       augugcauuucucaagcaaucucg 
5'   uucgcaa   cac gguu agguacugag ug cucucag                        u
     |||||||   ||| |||| |||||||||| || |||||||                         
3'   aagcguu   gug ccga ucuauggcuc ac gagaguc                        c
   aa       ---   a    a          c  -       ccaaaaaguuggaguccaggacuc 

Deep sequencing

2250 reads, 50 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.785: 213059-213187 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-306

• aae-mir-306: supercont1.785: 213059-213187 [+]
• aae-mir-79: supercont1.785: 213262-213357 [+]
• aae-mir-9b: supercont1.785: 213570-213661 [+]

Database links

• miRBase Tracker:MI0013446

Mature sequence aae-miR-306-5p

• Accession: MIMAT0014229
• Previous IDs: aae-miR-306
• Sequence: 20 - ucagguacugagugacucucag - 41
• Deep sequencing: 2209 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-306-3p

• Accession: MIMAT0014230
• Previous IDs: aae-miR-306*
• Sequence: 94 - gagagcaccucgguaucuaagc - 115
• Deep sequencing: 41 reads, 2 experiments
• Evidence: experimental; Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).