Stem-loop sequence aae-mir-965

AccessionMI0013474 (change log)
DescriptionAedes aegypti miR-965 stem-loop
Gene family MIPF0000708; mir-965
Literature search

1 open access papers mention aae-mir-965
(3 sentences)

Stem-loop
   gauu     gg      uc         g    uug   u 
5'     cugaa  gggaaa  cuguacgcu uaug   uau u
       |||||  ||||||  ||||||||| ||||   |||  
3'     ggcuu  cccuuu  gauaugcga auac   aua g
   -ugc     -a      uc         -    cua   a 
Get sequence
Deep sequencing
566 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.51: 2008650-2008728 [+]
intergenic
Database links

Mature sequence aae-miR-965

Accession MIMAT0014268
Sequence

52 - 

uaagcguauagcuuuucccauu

 - 73

Get sequence
Deep sequencing458 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).