Stem-loop sequence aae-mir-307

Accession MI0013501
Description Aedes aegypti miR-307 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop 
cuaguuuc   g      a  a         ccu  g       c  a 
        ccg cagucg uc cucacucaa   gg ugugaug uu u
        ||| |||||| || |||||||||   || ||||||| || u
        ggu guuagc ag gagugaguu   cc acacuac aa u
--------   a      c  c         ccu  a       u  g
Get sequence
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.16: 1859419-1859509 [-]
intergenic

Mature sequence aae-miR-307

Accession MIMAT0014296
Sequence

59 -  

cacaaccuccuugagugagcga

 - 80

Get sequence
Evidence experimental; 454 [1], Solexa [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).