Stem-loop sequence aae-let-7

AccessionMI0013505 (change log)
DescriptionAedes aegypti let-7 stem-loop
Gene family MIPF0000002; let-7
Literature search

4 open access papers mention aae-let-7
(10 sentences)

Stem-loop
       u    g    u             ugacug 
5' cacg ugag uagu gguuguauaguag      a
   |||| |||| |||| |||||||||||||      u
3' gugc guuc aucg cuaacguaucguc      u
       u    g    u             uauaaa 
Get sequence
Deep sequencing
1506303 reads, 7.52e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.43: 1156326-1156396 [+]
intergenic
Clustered miRNAs
< 10kb from aae-let-7
aae-let-7supercont1.43: 1156326-1156396 [+]
aae-mir-125supercont1.43: 1156595-1156689 [+]
Database links

Mature sequence aae-let-7

Accession MIMAT0014299
Sequence

6 - 

ugagguaguugguuguauagu

 - 26

Get sequence
Deep sequencing1506257 reads, 2 experiments
Evidence experimental; 454 [1]

References

1