Stem-loop sequence aae-mir-2943-2

AccessionMI0013508 (change log)
DescriptionAedes aegypti miR-2943-2 stem-loop
Gene family MIPF0001056; mir-2943
Literature search

2 open access papers mention aae-mir-2943-2
(9 sentences)

Stem-loop
        u       cacuu    g   au ug  gc 
5' gaugu aaguagg     gcag caa  u  ua  u
   ||||| |||||||     |||| |||  |  ||  u
3' uuaca uucaucc     cguc guu  a  au  u
        u       uuuuu    a   -- gu  aa 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.348: 481079-481149 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2943-2
aae-mir-2943-1supercont1.348: 480917-480997 [+]
aae-mir-2943-2supercont1.348: 481079-481149 [+]
Database links

Mature sequence aae-miR-2943

Accession MIMAT0014301
Sequence

5 - 

uuaaguaggcacuugcaggcaaa

 - 27

Get sequence
Deep sequencing154 reads, 2 experiments
Evidence experimental; 454 [1]

References

1