Stem-loop sequence aae-mir-2b

AccessionMI0013512 (change log)
DescriptionAedes aegypti miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention aae-mir-2b
(8 sentences)

Stem-loop
     -     u     a   -      -         a   -  uuu 
5' gg gcgua ucuag cuc ucaaag uggcuguga aug gu   a
   || ||||| ||||| ||| |||||| ||||||||| ||| ||    
3' cc cgcgu agguc gag aguuuc accgacacu uac cg   u
     a     c     -   u      g         a   u  uuu 
Get sequence
Deep sequencing
53749 reads, 2.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.268: 887244-887330 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2b
aae-mir-71supercont1.268: 889378-889454 [-]
aae-mir-2csupercont1.268: 889085-889162 [-]
aae-mir-13supercont1.268: 888736-888819 [-]
aae-mir-2asupercont1.268: 888581-888677 [-]
aae-mir-2bsupercont1.268: 887244-887330 [-]
Database links

Mature sequence aae-miR-2b

Accession MIMAT0014306
Sequence

52 - 

uaucacagccagcuuugaugagcu

 - 75

Get sequence
Deep sequencing51854 reads, 2 experiments
Evidence experimental; 454 [1]

References

1