Stem-loop sequence aae-mir-2c

AccessionMI0013514 (change log)
DescriptionAedes aegypti miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

3 open access papers mention aae-mir-2c
(5 sentences)

Stem-loop
   u      -g       u        uu   uacgaccu 
5'  gcguug  caucaaa uugguugu  uag        c
    ||||||  ||||||| ||||||||  |||        u
3'  cgcaac  guaguuu gaccgaca  auc        u
   a      ga       c        cu   cccaaagu 
Get sequence
Deep sequencing
51874 reads, 2.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.268: 889085-889162 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2c
aae-mir-71supercont1.268: 889378-889454 [-]
aae-mir-2csupercont1.268: 889085-889162 [-]
aae-mir-13supercont1.268: 888736-888819 [-]
aae-mir-2asupercont1.268: 888581-888677 [-]
aae-mir-2bsupercont1.268: 887244-887330 [-]
Database links

Mature sequence aae-miR-2c

Accession MIMAT0014308
Sequence

50 - 

uaucacagccagcuuugaugagc

 - 72

Get sequence
Deep sequencing51848 reads, 2 experiments
Evidence experimental; 454 [1]

References

1