Stem-loop sequence aae-mir-2946

AccessionMI0013532 (change log)
DescriptionAedes aegypti miR-2946 stem-loop
Literature search

1 open access papers mention aae-mir-2946
(1 sentences)

Stem-loop
          aa     g          a   c       uuucau 
5' uaugaac  ugauc ccauauuuuu ccg uacugca      u
   |||||||  ||||| |||||||||| ||| |||||||      g
3' auacuug  guuag gguauagaaa ggc augaugu      u
          gg     g          a   -       uaauaa 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.385: 413565-413652 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-2946
aae-mir-2946supercont1.385: 413565-413652 [-]
aae-mir-2941-2supercont1.385: 413436-413530 [-]
aae-mir-2941-1supercont1.385: 413127-413232 [-]
Database links

Mature sequence aae-miR-2946

Accession MIMAT0014325
Sequence

55 - 

uaguacggaaaagauaugggga

 - 76

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; 454 [1]

References

1