Stem-loop sequence hsv1-mir-H18

AccessionMI0013892 (change log)
DescriptionHerpes Simplex Virus 1 miR-H18 stem-loop
Stem-loop 
                   a  cc   accaa   g c           c 
5' cggucccgcccgccgg cg  ggg     cgg a ggcgggcggcc a
   |||||||||||||||| ||  |||     ||| | |||||||||||  
3' gccagggcgggcggcc gu  ccc     gcc u ccgcccgccgg a
                   g  ua   -cccc   g u           g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv1-miR-H18

Accession MIMAT0014696
Sequence

5 -  

cccgcccgccggacgccgggacc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).