Stem-loop sequence hsv2-mir-H11

AccessionMI0013898 (change log)
DescriptionHerpes Simplex Virus 2 miR-H11 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
       c                                                               a  u 
5' ucgg agggggcguggccgcccuucuaaaaaaagugagaacgcgaagcguucgcacuuuguccuaaua ua a
   |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  
3' aguu ucccccgcaccggcgggaagauuuuuuucacucuugcgcuucgcaagcgugaaacaggauuau au u
       -                                                               c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H11-5p

Accession MIMAT0014697
Previous IDshsv2-miR-H11*
Sequence

45 - 

aagcguucgcacuuuguccua

 - 65

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hsv2-miR-H11-3p

Accession MIMAT0014698
Previous IDshsv2-miR-H11
Sequence

81 - 

uuaggacaaagugcgaacgcuu

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).