Stem-loop sequence hsv2-mir-H12

AccessionMI0013899 (change log)
DescriptionHerpes Simplex Virus 2 miR-H12 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
         -c    c          c       a  u 
5' gggcgc  agug ucgcacuuug ccuaaua ua a
   ||||||  |||| |||||||||| ||||||| ||  
3' cuugcg  ucgc agcgugaagc ggauuau au u
         cu    a          a       c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H12

Accession MIMAT0014699
Sequence

43 - 

uuaggacgaagugcgaacgcuu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).