Stem-loop sequence hsv2-mir-H13

AccessionMI0013900 (change log)
DescriptionHerpes Simplex Virus 2 miR-H13 stem-loop
Gene family MIPF0000833; mir-H11
Stem-loop
      ga  c          c            u 
5' cgc  ag guucgcacuu guccuaauagua a
   |||  || |||||||||| ||||||||||||  
3' gcg  uc cgagcgugaa cgggauuauuau u
      -g  a          a            a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H13

Accession MIMAT0014700
Sequence

41 - 

uuagggcaaagugcgagcacug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).