Stem-loop sequence hsv2-mir-H19

AccessionMI0013901 (change log)
DescriptionHerpes Simplex Virus 2 miR-H19 stem-loop
Gene family MIPF0001247; mir-H4
Stem-loop
       a    u         a    a   c g  -  gc 
5' cggg cggg gaguucgcu ggca gca g ac ug  g
   |||| |||| ||||||||| |||| ||| | || ||  g
3' gccc gccc cucaaguga ccgu cgu c ug ac  u
       c    u         g    g   a g  c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H19

Accession MIMAT0014701
Sequence

14 - 

uucgcuaggcaagcacggacug

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).