Stem-loop sequence hsv2-mir-H20

AccessionMI0013902 (change log)
DescriptionHerpes Simplex Virus 2 miR-H20 stem-loop
Gene family MIPF0001760; mir-H20
Stem-loop
      c           c        g aau       acgc 
5' gga agggggggaga gagggguc g   ccaaagg    a
   ||| ||||||||||| |||||||| |   |||||||     
3' ccu ucccccccucu uuccccag c   gguuucc    g
      -           -        g auu       acca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H20

Accession MIMAT0014702
Sequence

49 - 

uuugguuacggaccccuuucu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).