Stem-loop sequence hsv2-mir-H21

AccessionMI0013903 (change log)
DescriptionHerpes Simplex Virus 2 miR-H21 stem-loop
Stem-loop
        -      cc  acc    -  ---c   c 
5' guuug uuucgu  ga   caug cg    cuc a
   ||||| ||||||  ||   |||| ||    |||  
3' cagac aaggca  cu   guac gc    gag u
        c      -u  guc    u  aaua   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H21

Accession MIMAT0014703
Sequence

36 - 

auaacgucaugcugucuacgg

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).