Stem-loop sequence hsv2-mir-H22

AccessionMI0013904 (change log)
DescriptionHerpes Simplex Virus 2 miR-H22 stem-loop
Stem-loop
            ucu     u   u    g   gga  g   gg 
5' ccccagggg   ggacg ggg gggc cgg   gc cgg  a
   |||||||||   ||||| ||| |||| |||   || |||   
3' ggggucccc   ccugc cuc uccg gcc   cg gcc  c
            ---     -   u    a   ---  g   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H22

Accession MIMAT0014704
Sequence

5 - 

aggggucuggacgugggugggc

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).