Stem-loop sequence hsv2-mir-H23

AccessionMI0013905 (change log)
DescriptionHerpes Simplex Virus 2 miR-H23 stem-loop
Stem-loop
        -gac    -  -             c    gaga   uca 
5' cgucc    ggag ag gccguggagcuug cagc    cgc   u
   |||||    |||| || ||||||||||||| ||||    |||   g
3' gcggg    ccuc uc uggcgcuucgagc guug    gcg   a
        accc    a  a             a    ---a   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H23-5p

Accession MIMAT0014705
Previous IDshsv2-miR-H23
Sequence

13 - 

aggccguggagcuugccagc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hsv2-miR-H23-3p

Accession MIMAT0014706
Previous IDshsv2-miR-H23*
Sequence

57 - 

acgagcuucgcgguacuacuc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).