Stem-loop sequence hsv2-mir-H24

AccessionMI0013906 (change log)
DescriptionHerpes Simplex Virus 2 miR-H24 stem-loop
Stem-loop
       c         c     g   c    g g c 
5' gcgg ggcgggggg aggcg cgg aggc c g g
   |||| ||||||||| ||||| ||| |||| | |  
3' cgcu ccgcccccc uccgc gcc uccg g c u
       c         u     g   -    g g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H24

Accession MIMAT0014707
Sequence

44 - 

cuccggcgccuuccccccgcccu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).