Stem-loop sequence hsv2-mir-H25

AccessionMI0013907 (change log)
DescriptionHerpes Simplex Virus 2 miR-H25 stem-loop
Stem-loop
   ---  c g          g       ac   --  g 
5'    gc g cgucccgguc ccgccgc  cag  gg c
      || | |||||||||| |||||||  |||  || a
3'    cg c gcagggccag ggcggcg  guc  cc c
   cgg  a g          a       -c   gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H25

Accession MIMAT0014708
Sequence

40 - 

cugcgcggcggagaccgggac

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).