Stem-loop sequence api-mir-7

AccessionMI0013936 (change log)
DescriptionAcyrthosiphon pisum miR-7 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention api-mir-7
(7 sentences)

Stem-loop
   --u          u      g     -uu    aaa 
5'    ggaagacuag gauuuu uuguu   aaaa   a
      |||||||||| |||||| |||||   ||||    
3'    ucuucugauc cugaag aacaa   uuuu   a
   cau          u      -     ucc    aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349691.1: 921851-921920 [+]
intergenic
Database links

Mature sequence api-miR-7

Accession MIMAT0014734
Sequence

1 - 

uggaagacuagugauuuuguuguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).