Stem-loop sequence mmu-mir-3065

AccessionMI0014027 (change log)
Symbol MGI:Mir3065
DescriptionMus musculus miR-3065 stem-loop
Gene family MIPF0001105; mir-3065
Literature search

2 open access papers mention mmu-mir-3065
(3 sentences)

Stem-loop
       -   c            a   a   a     g   cacug 
5' gcag cug ccucuucaacaa auc cug ugcug agu     u
   |||| ||| |||||||||||| ||| ||| ||||| |||      
3' uguc ggc ggagggguuguu uag gac acgac uca     g
       c   a            a   -   c     -   cccac 
Get sequence
Deep sequencing
307 reads, 4.76 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 120014767-120014853 [+]
antisense
OTTMUST00000009044 ; Aatk-008; intron 3
OTTMUST00000009043 ; Aatk-007; intron 4
OTTMUST00000009037 ; Aatk-001; intron 7
OTTMUST00000009038 ; Aatk-002; intron 7
OTTMUST00000009039 ; Aatk-003; intron 7
OTTMUST00000009040 ; Aatk-004; intron 7
ENSMUST00000083666 ; Mir338-201; exon 1
ENSMUST00000136386 ; Aatk-008; intron 3
ENSMUST00000132575 ; Aatk-007; intron 4
ENSMUST00000064307 ; Aatk-002; intron 7
ENSMUST00000150730 ; Aatk-004; intron 7
ENSMUST00000103020 ; Aatk-001; intron 7
ENSMUST00000103019 ; Aatk-003; intron 7
Clustered miRNAs
< 10kb from mmu-mir-3065
mmu-mir-338chr11: 120014765-120014862 [-]
mmu-mir-3065chr11: 120014767-120014853 [+]
Database links

Mature sequence mmu-miR-3065-5p

Accession MIMAT0014836
Previous IDsmmu-miR-3065
Sequence

14 - 

ucaacaaaaucacugaugcugg

 - 35

Get sequence
Deep sequencing248 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3065-3p

Accession MIMAT0014837
Previous IDsmmu-miR-3065*
Sequence

53 - 

ucagcaccaggauauuguugggg

 - 75

Get sequence
Deep sequencing54 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).