Stem-loop sequence mmu-mir-3069

AccessionMI0014031 (change log)
Symbol MGI:Mir3069
DescriptionMus musculus miR-3069 stem-loop
Literature search

2 open access papers mention mmu-mir-3069
(2 sentences)

Stem-loop
   -cu       caaga  u           cgga 
5'    uggcagu     ua uguuuagcaga    g
      |||||||     || |||||||||||     
3'    accguca     au acagguugucu    c
   aac       --uga  c           uugg 
Get sequence
Deep sequencing
365 reads, 0 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was retracted by the authors prior to publication [1].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 105031077-105031141 [-]
sense
ENSMUST00000158164 ; Scarna13-201; exon 1
Database links

Mature sequence mmu-miR-3069-5p

Accession MIMAT0014844
Sequence

2 - 

uuggcagucaagauauuguuuagc

 - 25

Get sequence
Deep sequencing182 reads, 41 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3069-3p

Accession MIMAT0014845
Sequence

43 - 

uuggacacuaaguacugccaca

 - 64

Get sequence
Deep sequencing154 reads, 51 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).