Stem-loop sequence mmu-mir-3073a

AccessionMI0014036 (change log)
Previous IDsmmu-mir-3073
Symbol MGI:Mir3073a
DescriptionMus musculus miR-3073 stem-loop
Literature search

1 open access papers mention mmu-mir-3073a
(1 sentences)

Stem-loop
       uu     c a           u    c      uagag 
5' gcug  ccugc c guggucacagu ggcg cagccc     u
   ||||  ||||| | ||||||||||| |||| ||||||      
3' cgac  ggacg g uaccaguguca cugu guuggg     c
       -c     u a           c    a      uagau 
Get sequence
Deep sequencing
216 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 112109238-112109322 [+]
sense
ENSMUST00000079400 ; Aspg-201; intron 1
Clustered miRNAs
< 10kb from mmu-mir-3073a
mmu-mir-3073achr12: 112109238-112109322 [+]
mmu-mir-3073bchr12: 112109250-112109309 [-]
Database links

Mature sequence mmu-miR-3073a-5p

Accession MIMAT0014854
Previous IDsmmu-miR-3073-5p
Sequence

15 - 

guggucacaguuggcgccagcc

 - 36

Get sequence
Deep sequencing109 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3073a-3p

Accession MIMAT0014855
Previous IDsmmu-miR-3073-3p
Sequence

53 - 

uugauguccacugugaccauag

 - 74

Get sequence
Deep sequencing103 reads, 13 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).