Stem-loop sequence mmu-mir-3082

AccessionMI0014045 (change log)
Symbol MGI:Mir3082
DescriptionMus musculus miR-3082 stem-loop
Literature search

5 open access papers mention mmu-mir-3082
(6 sentences)

Stem-loop
   --g a      g  u     -       -a   a 
5'    g cagagu ug guguc ugugugg  gac g
      | |||||| || ||||| |||||||  |||  
3'    c gucuca ac cacgg acacacc  uug g
   gga -      -  u     u       cg   a 
Get sequence
Deep sequencing
1681 reads, 1.23e+03 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 25831365-25831428 [-]
antisense
OTTMUST00000072861 ; Jmjd8-001; exon 9
ENSMUST00000180868 ; Gm26694-201; intron 1
ENSMUST00000133595 ; Jmjd8-001; exon 9
ENSMUST00000026832 ; Jmjd8-201; exon 9
Database links

Mature sequence mmu-miR-3082-5p

Accession MIMAT0014872
Sequence

2 - 

gacagagugugugugucugugu

 - 23

Get sequence
Deep sequencing183 reads, 73 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3082-3p

Accession MIMAT0014873
Sequence

42 - 

cacauggcacucaacucugcag

 - 63

Get sequence
Deep sequencing1492 reads, 64 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).