Stem-loop sequence mmu-mir-3091

AccessionMI0014084 (change log)
Symbol MGI:Mir3091
DescriptionMus musculus miR-3091 stem-loop
Literature search

1 open access papers mention mmu-mir-3091
(2 sentences)

Stem-loop
       -      c a    u     ug        gac 
5' ugcu ugcggg c uggg cuggu  ggcccgca   u
   |||| |||||| | |||| |||||  ||||||||   c
3' augg gcgucc g acuc gacca  ccgggcgu   g
       u      a a    u     gu        gag 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 180257536-180257611 [+]
sense
OTTMUST00000039064 ; Rps21-001; intron 1
OTTMUST00000039065 ; Rps21-002; intron 1
OTTMUST00000039067 ; Rps21-004; intron 1
OTTMUST00000039066 ; Rps21-003; intron 1
ENSMUST00000059080 ; Rps21-001; intron 1
ENSMUST00000148629 ; Rps21-002; intron 1
ENSMUST00000125301 ; Rps21-004; intron 1
ENSMUST00000145043 ; Rps21-003; intron 1
Database links

Mature sequence mmu-miR-3091-5p

Accession MIMAT0014903
Sequence

12 - 

caugggucugguugggcccgc

 - 32

Get sequence
Deep sequencing108 reads, 44 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3091-3p

Accession MIMAT0014904
Sequence

45 - 

cgggccugaccagucucaagac

 - 66

Get sequence
Deep sequencing79 reads, 34 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).