Stem-loop sequence mmu-mir-3093

AccessionMI0014086 (change log)
Symbol MGI:Mir3093
DescriptionMus musculus miR-3093 stem-loop
Literature search

2 open access papers mention mmu-mir-3093
(2 sentences)

Stem-loop
       cuc g    g c  ac       a cu     ucga     c 
5' cgag   g cucu c gc  cccgcgg g  cacac    ccuuc a
   ||||   | |||| | ||  ||||||| |  |||||    |||||  
3' gcuc   c gagg g ug  gggugcc c  gugug    ggaag g
       --- g    g u  ga       a ag     ----     a 
Get sequence
Deep sequencing
732 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 88215171-88215257 [+]
sense
OTTMUST00000112727 ; RP23-168E14.7-003; intron 1
OTTMUST00000112771 ; RP23-168E14.7-011; intron 1
OTTMUST00000112728 ; RP23-168E14.7-004; intron 1
OTTMUST00000112725 ; RP23-168E14.7-001; intron 2
OTTMUST00000112726 ; RP23-168E14.7-002; intron 2
ENSMUST00000181396 ; Gm3764-004; intron 1
ENSMUST00000181356 ; Gm3764-011; intron 1
ENSMUST00000181636 ; Gm3764-003; intron 1
ENSMUST00000180582 ; Gm3764-002; intron 2
ENSMUST00000181550 ; Gm3764-001; intron 2
Clustered miRNAs
< 10kb from mmu-mir-3093
mmu-mir-3093chr3: 88215171-88215257 [+]
mmu-mir-9-1chr3: 88215598-88215686 [+]
mmu-mir-9b-1chr3: 88215613-88215670 [-]
Database links

Mature sequence mmu-miR-3093-5p

Accession MIMAT0014907
Sequence

16 - 

cgcaccccgcggagcucacacu

 - 37

Get sequence
Deep sequencing77 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3093-3p

Accession MIMAT0014908
Sequence

56 - 

uguggacaccgugggagguugg

 - 77

Get sequence
Deep sequencing645 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).