Stem-loop sequence mmu-mir-3109

AccessionMI0014106 (change log)
Symbol MGI:Mir3109
DescriptionMus musculus miR-3109 stem-loop
Literature search

1 open access papers mention mmu-mir-3109
(1 sentences)

Stem-loop
       ug    --u   aa      c        ccaug    uc 
5' ugcc  cucc   gua  uggaug gaugguuc     cugu  u
   ||||  ||||   |||  |||||| ||||||||     ||||   
3' augg  gagg   cau  accuac cuaccggg     gacg  g
       ua    ugu   ag      u        aucga    ga 
Get sequence
Deep sequencing
405 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 69456944-69457031 [+]
sense
OTTMUST00000076481 ; Anxa2-001; intron 1
OTTMUST00000076484 ; Anxa2-004; intron 1
OTTMUST00000076483 ; Anxa2-003; intron 2
ENSMUST00000034756 ; Anxa2-001; intron 1
ENSMUST00000134907 ; Anxa2-004; intron 1
ENSMUST00000123470 ; Anxa2-003; intron 2
Database links

Mature sequence mmu-miR-3109-5p

Accession MIMAT0014949
Previous IDsmmu-miR-3109*
Sequence

15 - 

aauggaugcgaugguucccaugcu

 - 38

Get sequence
Deep sequencing245 reads, 45 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3109-3p

Accession MIMAT0014950
Previous IDsmmu-miR-3109
Sequence

54 - 

uagggccaucucauccagaua

 - 74

Get sequence
Deep sequencing157 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).