Stem-loop sequence oar-let-7b

AccessionMI0014113 (change log)
DescriptionOvis aries let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

14 open access papers mention oar-let-7b
(40 sentences)

Stem-loop
        u                     ucaggguagugaug 
5' cgggg gagguaguagguugugugguu              u
   ||||| |||||||||||||||||||||              u
3' guucc uuccgucauccaacauaucaa              g
        -                     uagaaggcuccccc 
Get sequence
Deep sequencing
374772 reads, 1.39e+05 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr3: 220323534-220323617 [+]
intergenic
Database links

Mature sequence oar-let-7b

Accession MIMAT0014963
Sequence

6 - 

ugagguaguagguuguguggu

 - 26

Get sequence
Deep sequencing372694 reads, 21 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).