Stem-loop sequence oar-let-7c

AccessionMI0014114 (change log)
DescriptionOvis aries let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

13 open access papers mention oar-let-7c
(41 sentences)

Stem-loop
     a      uu   g   u             ua  g ua a 
5' gc uccggg  gag uag agguuguaugguu  ga u  c c
   || ||||||  ||| ||| |||||||||||||  || |  | c
3' cg agguuc  uuc auc uccaacaugucaa  uu a  g c
     -      cu   g   u             --  g gg u 
Get sequence
Deep sequencing
465145 reads, 1.69e+05 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr1: 138651622-138651705 [-]
sense
ENSOART00000026019 ; oar-let-7c-201; exon 1
Clustered miRNAs
< 10kb from oar-let-7c
oar-mir-99achr1: 138652383-138652463 [-]
oar-let-7cchr1: 138651622-138651705 [-]
Database links

Mature sequence oar-let-7c

Accession MIMAT0014964
Sequence

11 - 

ugagguaguagguuguaugguu

 - 32

Get sequence
Deep sequencing465011 reads, 21 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).