Stem-loop sequence oar-mir-125b

Accession

MI0014121 (change log)

Description

Ovis aries miR-125b stem-loop

Gene family

MIPF0000033; mir-10

Literature search

8 open access papers mention oar-mir-125b
(12 sentences)

Stem-loop

   c     c   u  -a    u    c           au     c 
5'  gcgcg cuc ca  uccc gaga ccuaacuugug  guuua c
    ||||| ||| ||  |||| |||| |||||||||||  ||||| g
3'  cgcgc gag gu  aggg uucu ggauugggcac  uaaau u
   c     u   c  cg    -    c           -c     u 

Deep sequencing

397908 reads, 6.68e+04 reads per million, 13 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Oar_v4.0; GCA_000298735.2): chr15: 32240520-32240607 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0014121

Mature sequence oar-miR-125b

• Accession: MIMAT0014971
• Sequence: 15 - ucccugagacccuaacuugug - 35
• Deep sequencing: 397869 reads, 13 experiments
• Evidence: experimental; cloned [1-2]

References

1. PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2. PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).