![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence oar-mir-125b |
|||||
Accession | MI0014121 (change log) | ||||
Description | Ovis aries miR-125b stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
![]()
8 open access papers mention oar-mir-125b | ||||
Stem-loop |
c c u -a u c au c 5' gcgcg cuc ca uccc gaga ccuaacuugug guuua c ||||| ||| || |||| |||| ||||||||||| ||||| g 3' cgcgc gag gu aggg uucu ggauugggcac uaaau u c u c cg - c -c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence oar-miR-125b |
|
Accession | MIMAT0014971 |
Sequence |
15 - ucccugagacccuaacuugug - 35 |
Deep sequencing | 397869 reads, 13 experiments |
Evidence | experimental; cloned [1-2] |
References |
|
1 |
PMID:20140706
"Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses"
Mol Biol Rep. 38:3161-3171(2011).
|
2 |
PMID:23269700
"MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200"
Physiol Genomics. 45:151-161(2013).
|