![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3129 |
|||||
Accession | MI0014146 (change log) | ||||
Symbol | HGNC:MIR3129 | ||||
Description | Homo sapiens miR-3129 stem-loop | ||||
Gene family | MIPF0001458; mir-3129 | ||||
Literature search |
![]()
1 open access papers mention hsa-mir-3129 | ||||
Stem-loop |
gua ccu a 5' cuugggcaguaguguagagauugguuug guu a |||||||||||||||||||||||||||| ||| 3' gaacccgucgucacaucucuaaucaaac uaa u cga --u g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3129-5p |
|
Accession | MIMAT0014992 |
Previous IDs | hsa-miR-3129 |
Sequence |
9 - gcaguaguguagagauugguuu - 30 |
Deep sequencing | 302 reads, 59 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3129-3p |
|
Accession | MIMAT0019202 |
Sequence |
47 - aaacuaaucucuacacugcugc - 68 |
Deep sequencing | 127 reads, 61 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|