Stem-loop sequence hsa-mir-3129

Accession

MI0014146 (change log)

Symbol

HGNC:MIR3129

Description

Homo sapiens miR-3129 stem-loop

Gene family

MIPF0001458; mir-3129

Literature search

1 open access papers mention hsa-mir-3129
(73 sentences)

Stem-loop

   gua                            ccu   a 
5'    cuugggcaguaguguagagauugguuug   guu a
      ||||||||||||||||||||||||||||   |||  
3'    gaacccgucgucacaucucuaaucaaac   uaa u
   cga                            --u   g 

Deep sequencing

431 reads, 0 reads per million, 95 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 189133036-189133111 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000334695 ; AC068718.1-001; intron 1

  OTTHUMT00000334696 ; AC068718.1-002; intron 1

  ENST00000434418 ; LINC01090-001; intron 1

  ENST00000415357 ; LINC01090-002; intron 1

Database links

• EntrezGene:MIR3129
• HGNC:MIR3129
• RNAcentral:URS000075992D_9606
• miRBase Tracker:MI0014146

Mature sequence hsa-miR-3129-5p

• Accession: MIMAT0014992
• Previous IDs: hsa-miR-3129
• Sequence: 9 - gcaguaguguagagauugguuu - 30
• Deep sequencing: 302 reads, 59 experiments
• Evidence: experimental; Illumina [1-3]
• Database links:
  • RNAcentral:URS00000F7766_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3129-5p
  • TargetScanVert:hsa-miR-3129-5p
  • miRDB:hsa-miR-3129-5p
  • microrna.org:hsa-miR-3129-5p

Mature sequence hsa-miR-3129-3p

• Accession: MIMAT0019202
• Sequence: 47 - aaacuaaucucuacacugcugc - 68
• Deep sequencing: 127 reads, 61 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS000033351F_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3129-3p
  • TargetScanVert:hsa-miR-3129-3p
  • miRDB:hsa-miR-3129-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).