Stem-loop sequence hsa-mir-3131

AccessionMI0014151 (change log)
Symbol HGNC:MIR3131
DescriptionHomo sapiens miR-3131 stem-loop
Literature search

1 open access papers mention hsa-mir-3131
(1 sentences)

Stem-loop 
      uc    a    u  -a        --  cc 
5' gag  gagg cugg gg  agggccuu  uc  c
   |||  |||| |||| ||  ||||||||  ||   
3' cuc  cuuc gacc cc  ucccggaa  ag  u
      uu    -    -  gg        cc  ac
Get sequence
Deep sequencing
385 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 219058688-219058750 [-]
intergenic
Database links

Mature sequence hsa-miR-3131

Accession MIMAT0014996
Sequence

4 -  

ucgaggacugguggaagggccuu

 - 26

Get sequence
Deep sequencing375 reads, 59 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).