![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3131 |
|||||
Accession | MI0014151 (change log) | ||||
Symbol | HGNC:MIR3131 | ||||
Description | Homo sapiens miR-3131 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-3131 | ||||
Stem-loop |
uc a u -a -- cc 5' gag gagg cugg gg agggccuu uc c ||| |||| |||| || |||||||| || 3' cuc cuuc gacc cc ucccggaa ag u uu - - gg cc ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3131 |
|
Accession | MIMAT0014996 |
Sequence |
4 - ucgaggacugguggaagggccuu - 26 |
Deep sequencing | 375 reads, 59 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|