![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-466 |
|||||
Accession | MI0014157 (change log) | ||||
Symbol | HGNC:MIR466 | ||||
Description | Homo sapiens miR-466 stem-loop | ||||
Gene family | MIPF0000316; mir-467 | ||||
Literature search |
![]()
18 open access papers mention hsa-mir-466 | ||||
Stem-loop |
a a uau 5' guguguguauauguguguugc ugugugu uaugugug a ||||||||||||||||||||| ||||||| |||||||| 3' cguacauauauacacacaacg acauaca auacacau u c c gua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-466 |
|
Accession | MIMAT0015002 |
Sequence |
52 - auacacauacacgcaacacacau - 74 |
Deep sequencing | 65 reads, 32 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|