![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3136 |
|||||
Accession | MI0014158 (change log) | ||||
Symbol | HGNC:MIR3136 | ||||
Description | Homo sapiens miR-3136 stem-loop | ||||
Gene family | MIPF0001575; mir-3136 | ||||
Literature search |
1 open access papers mention hsa-mir-3136 | ||||
Stem-loop |
a a uuuuuc a 5' aauaug aacugacugaauaggu ggguca ugug c |||||| |||||||||||||||| |||||| |||| 3' uuauac uugauugacuuaucca cccggu acac u c a ------ g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3136-5p |
|
Accession | MIMAT0015003 |
Previous IDs | hsa-miR-3136 |
Sequence |
10 - cugacugaauagguagggucauu - 32 |
Deep sequencing | 434 reads, 87 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3136-3p |
|
Accession | MIMAT0019203 |
Sequence |
49 - uggcccaaccuauucaguuagu - 70 |
Deep sequencing | 20 reads, 11 experiments |
Evidence | experimental; Illumina [2-3] |
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|