![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-544b |
|||||
Accession | MI0014159 (change log) | ||||
Symbol | HGNC:MIR544B | ||||
Description | Homo sapiens miR-544b stem-loop | ||||
Gene family | MIPF0000436; mir-544 | ||||
Literature search |
![]()
13 open access papers mention hsa-mir-544b | ||||
Stem-loop |
a - g - uu uag u 5' gg auuuuguua aaaugca aauc ca ucug c c || ||||||||| ||||||| |||| || |||| | u 3' cc ugaaacaau uuuacgu uugg gu agau g g g c g a cc -ca a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-544b |
|
Accession | MIMAT0015004 |
Sequence |
48 - accugagguugugcauuucuaa - 69 |
Deep sequencing | 99 reads, 22 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|