![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3140 |
|||||
Accession | MI0014163 (change log) | ||||
Symbol | HGNC:MIR3140 | ||||
Description | Homo sapiens miR-3140 stem-loop | ||||
Gene family | MIPF0001615; mir-3140 | ||||
Stem-loop |
-c g a a a ugaa 5' cucuugag uaccugaauu ccaaaagcuuu ugu uuc g |||||||| |||||||||| ||||||||||| ||| ||| 3' gaggacuu auggacuuaa gguuuucgaga aua aag u gu g g - a uuau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3140-5p |
|
Accession | MIMAT0019204 |
Sequence |
12 - accugaauuaccaaaagcuuu - 32 |
Deep sequencing | 121 reads, 22 experiments |
Evidence | experimental; Illumina [3-4] |
Predicted targets |
|
Mature sequence hsa-miR-3140-3p |
|
Accession | MIMAT0015008 |
Previous IDs | hsa-miR-3140 |
Sequence |
60 - agcuuuugggaauucagguagu - 81 |
Deep sequencing | 534 reads, 67 experiments |
Evidence | experimental; Illumina [1-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
4 |
PMID:21606961
"Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia"
Leukemia. 25:1389-1399(2011).
|