Stem-loop sequence hsa-mir-3140

Accession

MI0014163 (change log)

Symbol

HGNC:MIR3140

Description

Homo sapiens miR-3140 stem-loop

Gene family

MIPF0001615; mir-3140

Stem-loop

   -c        g          a           a   a   ugaa 
5'   cucuugag uaccugaauu ccaaaagcuuu ugu uuc    g
     |||||||| |||||||||| ||||||||||| ||| |||     
3'   gaggacuu auggacuuaa gguuuucgaga aua aag    u
   gu        g          g           -   a   uuau 

Deep sequencing

670 reads, 0 reads per million, 73 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr4: 152489327-152489416 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000365691 ; FAM160A1-003; intron 2

  OTTHUMT00000365692 ; FAM160A1-004; intron 3

  OTTHUMT00000365696 ; FAM160A1-008; intron 3

  OTTHUMT00000365695 ; FAM160A1-007; intron 4

  ENST00000505231 ; FAM160A1-003; intron 2

  ENST00000503146 ; FAM160A1-004; intron 3

  ENST00000512597 ; FAM160A1-008; intron 3

  ENST00000513962 ; FAM160A1-007; intron 4

  ENST00000435205 ; FAM160A1-201; intron 4

Database links

• EntrezGene:MIR3140
• HGNC:MIR3140
• RNAcentral:URS000075E6D4_9606
• miRBase Tracker:MI0014163

Mature sequence hsa-miR-3140-5p

• Accession: MIMAT0019204
• Sequence: 12 - accugaauuaccaaaagcuuu - 32
• Deep sequencing: 121 reads, 22 experiments
• Evidence: experimental; Illumina [3-4]
• Predicted targets:
  • TargetMiner:hsa-miR-3140-5p
  • TargetScanVert:hsa-miR-3140-5p
  • miRDB:hsa-miR-3140-5p

Mature sequence hsa-miR-3140-3p

• Accession: MIMAT0015008
• Previous IDs: hsa-miR-3140
• Sequence: 60 - agcuuuugggaauucagguagu - 81
• Deep sequencing: 534 reads, 67 experiments
• Evidence: experimental; Illumina [1-4]
• Database links:
  • RNAcentral:URS000006B702_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3140-3p
  • TargetScanVert:hsa-miR-3140-3p
  • miRDB:hsa-miR-3140-3p
  • microrna.org:hsa-miR-3140-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
4. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).